Bioinformatics Unit 3: Exercise

SSU Home | SSU Biology | SiteMap | Search | CourseInfo | Forum | Home

Glossary   |   Self Tests   |   Software   |   Objectives   |   Articles


Unit 3: Molecular Genetics
Useful Tools

Pre-Exercise

Exercise

Part 1- Molecular biology tools for primers & restriction mapping

Part 2- Designing and selecting probes

Summary questions

.

Useful Tools

Primers, plasmids, and probes


Objectives:

Use and extend what you've learned in the first two units to better connect bioinformatics with wet lab methods and experimentation.

  • Use TACG to identify restriction sites in a sequence
  • Design and evaluate primer pairs and probe sequences
  • Locate resources on plasmids

Introduction:

When working on DNA sequencing or using PCR, there is a periodic need for some simple computational applications. Designing primer pairs and locating restriction sites are two examples. Depending on the project, there may also be a need for selecting appropriate plasmids to meet the intended goals. Primers can often be designed by visually inspecting a sequence for short [15-25 bp] sequences which satisfy defined criteria- 1) the sequence pairs should be of equal length, 2) have at least 50% G+C content, and 3) anneal at about the same temperature, ideally between 50-65oC. The last two criteria can be easily calculated. There are several primer design programs which can be used to assist in the design process. [They do not, however; eliminate having to experimentally verify their function and optimize reactions.] You will have the opportunity of playing with Primer 3 in Biology Workbench, and you are welcome to explore others as well. For restriction site mapping, there are a variety of programs which include a site mapping feature, including Sequencher and also TACG in Biology Workbench.

Finding and using genetic markers has long been recognized as being extremely useful in a wide variety of applications. Examples include recognition of disease gene polymorphisms, use in studies of pathogens and epidemiology, selection of plants for desirable agricultural characteristics such as seed yield or height, and analysis of forensic evidence for civil and criminal court cases. The combination of more means of identification of polymorphisms along with the capability of genomic analysis has brought considerable improvements in these areas of inquiry. Additionally as a result of these advances, other areas are undergoing rapid expansion and development. Gene identification and association with function(s) in metabolism, development and cell differentiation, and various response systems are some examples. Means of identifying polymorphisms include restriction fragment length polymorphism [RFLP] and use of probes for specific gene markers, either as part of the gene in question or a closely linked marker to the gene of interest. Designing probes is much like primer design. The object is to select a sequence which is both specific for the target and which has desirable characteristics compatible with the assay application.

There are summary questions at the end of this section. Points = 0. [Optional section]

  [top of page]

Pre-Exercise:

For an introduction to restriction enzymes, try:

http://www.accessexcellence.org/AE/AEC/CC/restriction.html

http://www.ultranet.com/~jkimball/BiologyPages/R/RestrictionEnzymes.html [This site also gives links to information on DNA sequencing and recombinant DNA.]

 

  [top of page]

Exercise:

Part 1 - Molecular biology tools for primers & restriction mapping

This section will give you a little exposure to tools which are useful in a lab using molecular biology techniques.

A. Designing primers

1. Background & tools for primer design. Check out the following sites to become familiar with available tools for primer design.

http://www.chemie.uni-marburg.de/~becker/ [There are other good resources, such as for restriction analysis, here as well.]

http://www.hgmp.mrc.ac.uk/GenomeWeb/nuc-primer.html

Browse a few of these to get a feel for what they have to offer. Among the available freeware, GeneWalker, Primer3, and PrimerDesign are frequently cited and recommended. You can also use Primer3 in Biology Workbench.

The following is the complete mRNA sequence for ubiquitin C-terminal hydrolase in equine. The protein is of interest in that it has been found in the synovial fluid at above-normal concentrations in horses suffering from osteoarthritis.

>gi|10336505|dbj|AB049188.1|AB049188

CTGTTTTTCCTACTCCCTGGCTTCTCCTCCTTCTCGCTCTTCGCGAAGATGCAGCTCAAACCGATGGAGA
TTAACCCCGAGATGCTGAACAAAGTGCTGGCCAGGCTGGGGGTCGCCGGCCAGTGGCGCTTCGTGGACGT
GCTGGGGCTGGAGGAGGAGACTCTGGGCTCGGTGCCAGCGCCTGCCTGCGCCTTGCTGCTGCTGTTTCCC
CTCACGGCCCAGCATGAGAACTTCAGGAAAAAACAGATTGAAGAACTGAAGGGACAAGAAGTCAGTCCTA
AGGTGTACTTCATGAAGCAGACCATTGGGAACTCCTGCGGTACCATCGGACTTATCCACGCCGTGGCCAA
TAACCAGGACAAACTGGAGTTTGAGGATGGATCGGTCCTGAAACAATTTCTTTCTGAAACGGAGAAGTTA
TCCCCTGAAGACAGAGCCAAATGCTTTGAAAAGAATGAGGCCATTCAGGCAGCCCATGATGCTGTGGCAC
AGGAAGGCCAATGTCGGGTAGATGACAAAGTGAACTTTCATTTTATTCTGTTTAACAACGTGGATGGCCA
CCTCTATGAACTTGATGGGCGGATGCCTTTCCCGGTGAACCATGGCACCAGTTCAGAGGACCTGCTGCTG
CAGGACGCCGCCAAGGTCTGCAGAGAATTCACTGAGCGTGAGCAAGGCGAAGTCCGCTTTTCTGCTGTGG
CGCTCTGCAAGGCAGCCTAATGCCCTGTAAGAGGGACTTGGCTTTTTTCCTCTCTCCCCTTCAACGTGAA
ATATATCCTGACCGATGCAGTCTAAGATGCTTCCCTACTTGTAGAACACAGCTGTTCTCCTTTGGTTCTG
CAGGCCTGCTCCTCCCCTCCGCCACACCCAAGCACTAGCAGAGCTCAGCTGTCGATCGAGCAAAGTTTGG
TGTAAGCTTCAGGTGGCGAAGCATTTCCCCCAGTGTATGTCTTGTATCTCAATATCTAATGCTTTAAATG
GCTACTTTGGTTTGTGTCTGTAAGTTAAGGCCTTGGATGTGGTTTAATTGTTTGTCCTTAAAAGGAATAA
AACTTTTCTGCTGATAAGAAAAAAAAAAAAAAAAAAAAAA

2. Find 3-4 primer pairs which could be used to help fully sequence the gene. You may use Primer3 or another program of your choosing.

3. Briefly outline how you would test the functionality of the designed primers.

4. Briefly outline how you would test the specificity of the designed primers.


B. Restriction mapping.

1. Background, resources and tools for restriction enzymes. Check out the following sites to get a feel for some of what is available. [The first 2 sites were listed in the pre-exercise, so you should have browsed them already.]

http://www.accessexcellence.org/AE/AEC/CC/restriction.html [This site has a handy chart of the common restriction enzymes and the sites which they recognize.]

http://www.ultranet.com/~jkimball/BiologyPages/R/RestrictionEnzymes.html [This site also gives links to information on DNA sequencing and recombinant DNA.]

Resource list of restriction enzymes by type & commercial availability:

http://internalmed.wustl.edu/divisions/enzymes/INDEX.HTM

2. Using the sequence in A above, create a restriction map showing the cut sites for 2 enzymes of your choosing. Use TACG in Biology Workbench or Sequencher, or another program of your choosing, along with resource information on restriction enzymes.


C. Selecting plasmids.

1. DNA Information Corner is great resource site for all sorts of things molecular:

http://www.dur.ac.uk/~dbl0www/Bioinformatics/DNA_corner.htm

To browse what they have on plasmids, look under "Vectors".

2. Tutorial exercises in plasmid mapping: Get a partner to do some of these- it's more fun that way.

http://www.carolina.com/biotech/plasmid_problems/plasmid_guide.asp

This section isn't intended to be comprehensive on plasmids. It is intended to be an introductory tour. [For some basics, refer to you notes from Jim Christmann's presentations in Unit 2.] It is beyond the scope of this course to get into all the issues involved in making an informed decision in selecting the best plasmid for the particular task at hand. But do think about these questions:

a. How can having a restriction map on an mRNA or cDNA sequence be useful in helping to select a plasmid for cloning?

b. Why do some plasmids have several different restriction sites in specific regions, especially within an antibiotic gene or an enzyme gene?

 [top of page]

Part 2- Designing and selecting probes

Molecular probes are used in a variety of applications, such as Southern and Northern blots and microarrays. For a sequence to be useful as a probe, it needs to be specific for the target sequence. It must not bind to anything else which might be present in the sample being screened. Designing probes is similar to designing primer pairs. In fact, one way to begin is to use some of the same design programs. Other approaches work as well.

Tissue typing provides an excellent example of an activity which has been accomplished using a variety of methodologies over the years, including the development and use of probes. Screening for human major histocompatibility complex [MHC] antigens is required for tissue typing of possible donors for organ transplants and of the recipients. It is also useful in genetic linkage analysis for a variety of disease associations. Originally, screening was done using a cytotoxicity assay system for some of the loci, and a mixed lymphocyte response [MLR] assay for other loci. Use of RFLPs was introduced in the late 1980's followed by introduction of PCR methods in the 1990's. Microarrays are now being developed and introduced for HLA screening.

A. To become familiar with HLA and tissue typing, try the following tutorial which includes information on the different screening methods:

http://www.umds.ac.uk/tissue/what1.html

For cutting edge approaches, the following papers are of interest:

Feolo M, Fuller TC, Taylor M, Zone JJ, Neuhausen SL, 2001. A strategy for high throughput HLA-DQ typing. J Immunol Methods 2001 Dec 1;258(1-2):65-71 [Elsevier]

Cai H, White PS, Torney D, Deshpande A, Wang Z, Keller RA, Marrone B, Nolan JP., 2000. Flow cytometry-based minisequencing: a new platform for high-throughput single-nucleotide polymorphism scoring. Genomics 2000 Jun 1;66(2):135-43. Erratum in: Genomics 2000 Nov 1;69(3):395 [Elsevier]

If you are interested in more resources on HLA and typing, a worthy site to visit is the Anthony Nolan Bone Marrow Trust:

http://www.anthonynolan.org.uk/HIG.

For a different application using probes, check out the following site:

http://www.gov.on.ca/OMAFRA/english/research/magazine/june96/pdf%20files/29DNA.PDF

 

B. Constructing a probe.

The HLA allele with the strongest association with a disease is HLA B27. It has a strong association frequency with ankylosing spondylitis and one type of arthritis. Therefore it is of interest to screen for the presence of this particular allele. The complete mRNA sequence for B27 is in GenBank:

gi|187657|gb|M12678.1|HUMMHB27A

Using a method of your choosing, design a probe of 20-30 nucleotides which will detect the presence of B27 in DNA samples. [See Summary question 2 below.]

1. Outline your approach.

2. Give the sequence you designed.

3. Test your sequence for specificity to B27 and verify that it recognizes only B27 and no other B allele, nor any other gene, in the human genome.

4. As a followup on HLA B27's association in disease, you may be interested in reading the following paper which combines two computational methods to identify peptide sequences from Chlamydia trachomatis predicted to be involved in binding B27 and which may be involved in the pathogenesis of B27 associated disease.

Kuon W, et al, 2001. Identification of HLA-B27-restricted peptides from the Chlamydia trachomatis proteome with possible relevance to HLA-B27-associated diseases. J Immunol Oct 15;167(8):4738-4746.
 [top of page]

Summary Questions:

Try to limit your answers to 2-3 typed pages [12 pt font]. This length should be sufficient for your comments and any appropriate copy/pasted examples. [You need not retype or copy/paste the questions as part of your responses.]

1. Primers, restriction mapping, and plasmids- using the tools:

a. What program did you use for primer design? How did you assess the specificity of the primers?

b. For primers, it is important to avoid self-complimentarity, especially at 3' end. Why is that?

c. What program did you use for restriction mapping? What enzymes did you select? What were your results?

d. Describe two uses for doing restriction mapping on a sequence.

e. How can having a restriction map on an mRNA or cDNA sequence be useful in helping to select a plasmid for cloning?

f. Why do some plasmids have several different restriction sites in specific regions, especially within an antibiotic gene or an enzyme gene?

g. What factors dictate restriction enzyme choice? [This may seem a little redundant to the preceding questions, or it may not, depending on how you have answered so far.]

2. Designing a probe:

a. Outline your approach for designing a probe specific for HLA B27.

b. Give the sequence you designed.

c. Summarize how you verified the specificity of your probe.

 [top of page]

.[

SSU Home | SSU Biology | SiteMap | Search | CourseInfo | Forum | Home

Glossary   |   Self Tests   |   Software   |   Objectives   |   Articles

Updated 10/20/03 by thatcher@sonoma.edu