Useful Tools
Primers, plasmids, and probes
Objectives:
Use and extend what you've learned in the first two units
to better connect bioinformatics with wet lab methods and
experimentation.
- Use TACG to identify restriction sites in a
sequence
- Design and evaluate primer pairs and probe
sequences
- Locate resources on plasmids
Introduction:
When working on DNA sequencing or using PCR, there is a
periodic need for some simple computational applications.
Designing primer pairs and locating restriction sites are
two examples. Depending on the project, there may also be a
need for selecting appropriate plasmids to meet the intended
goals. Primers can often be designed by visually inspecting
a sequence for short [15-25 bp] sequences which
satisfy defined criteria- 1) the sequence pairs should be of
equal length, 2) have at least 50% G+C content, and 3)
anneal at about the same temperature, ideally between
50-65oC.
The last two criteria can be easily calculated. There are
several primer design programs which can be used to assist
in the design process. [They do not, however; eliminate
having to experimentally verify their function and optimize
reactions.] You will have the opportunity of playing
with Primer 3 in Biology Workbench, and you are
welcome to explore others as well. For restriction site
mapping, there are a variety of programs which include a
site mapping feature, including Sequencher and
also TACG in Biology Workbench.
Finding and using genetic markers has long been
recognized as being extremely useful in a wide variety of
applications. Examples include recognition of disease gene
polymorphisms, use in studies of pathogens and epidemiology,
selection of plants for desirable agricultural
characteristics such as seed yield or height, and analysis
of forensic evidence for civil and criminal court cases. The
combination of more means of identification of polymorphisms
along with the capability of genomic analysis has brought
considerable improvements in these areas of inquiry.
Additionally as a result of these advances, other areas are
undergoing rapid expansion and development. Gene
identification and association with function(s) in
metabolism, development and cell differentiation, and
various response systems are some examples. Means of
identifying polymorphisms include restriction fragment
length polymorphism [RFLP] and use of probes for
specific gene markers, either as part of the gene in
question or a closely linked marker to the gene of interest.
Designing probes is much like primer design. The object is
to select a sequence which is both specific for the target
and which has desirable characteristics compatible with the
assay application.
There are summary questions at the end of this
section. Points = 0. [Optional section]
[top of
page]
Pre-Exercise:
For an introduction to restriction enzymes,
try:
http://www.accessexcellence.org/AE/AEC/CC/restriction.html
http://www.ultranet.com/~jkimball/BiologyPages/R/RestrictionEnzymes.html
[This site also gives links to information on DNA
sequencing and recombinant DNA.]
[top of
page]
Exercise:
Part 1 - Molecular biology tools for
primers & restriction mapping
This section will give you a little exposure to tools
which are useful in a lab using molecular biology
techniques.
A. Designing primers
1. Background & tools for primer design. Check
out the following sites to become familiar with available
tools for primer design.
http://www.chemie.uni-marburg.de/~becker/
[There are other good resources, such as for
restriction analysis, here as well.]
http://www.hgmp.mrc.ac.uk/GenomeWeb/nuc-primer.html
Browse a few of these to get a feel for what they have to
offer. Among the available freeware, GeneWalker,
Primer3, and PrimerDesign are frequently cited
and recommended. You can also use Primer3 in Biology
Workbench.
The following is the complete mRNA sequence for ubiquitin
C-terminal hydrolase in equine. The protein is of interest
in that it has been found in the synovial fluid at
above-normal concentrations in horses suffering from
osteoarthritis.
>gi|10336505|dbj|AB049188.1|AB049188
CTGTTTTTCCTACTCCCTGGCTTCTCCTCCTTCTCGCTCTTCGCGAAGATGCAGCTCAAACCGATGGAGA
TTAACCCCGAGATGCTGAACAAAGTGCTGGCCAGGCTGGGGGTCGCCGGCCAGTGGCGCTTCGTGGACGT
GCTGGGGCTGGAGGAGGAGACTCTGGGCTCGGTGCCAGCGCCTGCCTGCGCCTTGCTGCTGCTGTTTCCC
CTCACGGCCCAGCATGAGAACTTCAGGAAAAAACAGATTGAAGAACTGAAGGGACAAGAAGTCAGTCCTA
AGGTGTACTTCATGAAGCAGACCATTGGGAACTCCTGCGGTACCATCGGACTTATCCACGCCGTGGCCAA
TAACCAGGACAAACTGGAGTTTGAGGATGGATCGGTCCTGAAACAATTTCTTTCTGAAACGGAGAAGTTA
TCCCCTGAAGACAGAGCCAAATGCTTTGAAAAGAATGAGGCCATTCAGGCAGCCCATGATGCTGTGGCAC
AGGAAGGCCAATGTCGGGTAGATGACAAAGTGAACTTTCATTTTATTCTGTTTAACAACGTGGATGGCCA
CCTCTATGAACTTGATGGGCGGATGCCTTTCCCGGTGAACCATGGCACCAGTTCAGAGGACCTGCTGCTG
CAGGACGCCGCCAAGGTCTGCAGAGAATTCACTGAGCGTGAGCAAGGCGAAGTCCGCTTTTCTGCTGTGG
CGCTCTGCAAGGCAGCCTAATGCCCTGTAAGAGGGACTTGGCTTTTTTCCTCTCTCCCCTTCAACGTGAA
ATATATCCTGACCGATGCAGTCTAAGATGCTTCCCTACTTGTAGAACACAGCTGTTCTCCTTTGGTTCTG
CAGGCCTGCTCCTCCCCTCCGCCACACCCAAGCACTAGCAGAGCTCAGCTGTCGATCGAGCAAAGTTTGG
TGTAAGCTTCAGGTGGCGAAGCATTTCCCCCAGTGTATGTCTTGTATCTCAATATCTAATGCTTTAAATG
GCTACTTTGGTTTGTGTCTGTAAGTTAAGGCCTTGGATGTGGTTTAATTGTTTGTCCTTAAAAGGAATAA
AACTTTTCTGCTGATAAGAAAAAAAAAAAAAAAAAAAAAA
2. Find 3-4 primer pairs which could be used to
help fully sequence the gene. You may use Primer3 or
another program of your choosing.
3. Briefly outline how you would test the
functionality of the designed primers.
4. Briefly outline how you would test the
specificity of the designed primers.
B. Restriction mapping.
1. Background, resources and tools for restriction
enzymes. Check out the following sites to get a feel for
some of what is available. [The first 2 sites were
listed in the pre-exercise, so you should have browsed them
already.]
http://www.accessexcellence.org/AE/AEC/CC/restriction.html
[This site has a handy chart of the common
restriction enzymes and the sites which they
recognize.]
http://www.ultranet.com/~jkimball/BiologyPages/R/RestrictionEnzymes.html
[This site also gives links to information on DNA
sequencing and recombinant DNA.]
Resource list of restriction enzymes by type &
commercial availability:
http://internalmed.wustl.edu/divisions/enzymes/INDEX.HTM
2. Using the sequence in A above, create a
restriction map showing the cut sites for 2 enzymes of your
choosing. Use TACG in Biology Workbench or
Sequencher, or another program of your choosing,
along with resource information on restriction enzymes.
C. Selecting plasmids.
1. DNA Information Corner is great resource site for
all sorts of things molecular:
http://www.dur.ac.uk/~dbl0www/Bioinformatics/DNA_corner.htm
To browse what they have on plasmids, look under
"Vectors".
2. Tutorial exercises in plasmid mapping: Get a
partner to do some of these- it's more fun that way.
http://www.carolina.com/biotech/plasmid_problems/plasmid_guide.asp
This section isn't intended to be comprehensive on
plasmids. It is intended to be an introductory tour.
[For some basics, refer to you notes from Jim
Christmann's presentations in Unit 2.] It is beyond the
scope of this course to get into all the issues involved in
making an informed decision in selecting the best plasmid
for the particular task at hand. But do think about these
questions:
a. How can having a restriction map on an
mRNA or cDNA sequence be useful in helping to select a
plasmid for cloning?
b. Why do some plasmids have several different
restriction sites in specific regions, especially within
an antibiotic gene or an enzyme gene?
[top
of page]
Part 2- Designing and selecting
probes
Molecular probes are used in a variety of applications,
such as Southern and Northern blots and microarrays. For a
sequence to be useful as a probe, it needs to be specific
for the target sequence. It must not bind to anything else
which might be present in the sample being screened.
Designing probes is similar to designing primer pairs. In
fact, one way to begin is to use some of the same design
programs. Other approaches work as well.
Tissue typing provides an excellent example of an
activity which has been accomplished using a variety of
methodologies over the years, including the development and
use of probes. Screening for human major histocompatibility
complex [MHC] antigens is required for tissue typing
of possible donors for organ transplants and of the
recipients. It is also useful in genetic linkage analysis
for a variety of disease associations. Originally, screening
was done using a cytotoxicity assay system for some of the
loci, and a mixed lymphocyte response [MLR] assay
for other loci. Use of RFLPs was introduced in the late
1980's followed by introduction of PCR methods in the
1990's. Microarrays are now being developed and introduced
for HLA screening.
A. To become familiar with HLA and tissue typing,
try the following tutorial which includes information
on the different screening methods:
http://www.umds.ac.uk/tissue/what1.html
For cutting edge approaches, the following papers are of
interest:
Feolo M, Fuller TC, Taylor M, Zone JJ, Neuhausen
SL, 2001. A strategy for high throughput HLA-DQ typing.
J Immunol Methods 2001 Dec 1;258(1-2):65-71
[Elsevier]
Cai H, White PS, Torney D, Deshpande A, Wang Z, Keller
RA, Marrone B, Nolan JP., 2000. Flow cytometry-based
minisequencing: a new platform for high-throughput
single-nucleotide polymorphism scoring. Genomics 2000 Jun
1;66(2):135-43. Erratum in: Genomics 2000 Nov 1;69(3):395
[Elsevier]
If you are interested in more resources on HLA and
typing, a worthy site to visit is the Anthony Nolan Bone
Marrow Trust:
http://www.anthonynolan.org.uk/HIG.
For a different application using probes, check out the
following site:
http://www.gov.on.ca/OMAFRA/english/research/magazine/june96/pdf%20files/29DNA.PDF
B. Constructing a probe.
The HLA allele with the strongest association with a
disease is HLA B27. It has a strong association frequency
with ankylosing spondylitis and one type of arthritis.
Therefore it is of interest to screen for the presence of
this particular allele. The complete mRNA sequence for B27
is in GenBank:
gi|187657|gb|M12678.1|HUMMHB27A
Using a method of your choosing, design a probe of 20-30
nucleotides which will detect the presence of B27 in DNA
samples. [See Summary question 2 below.]
1. Outline your approach.
2. Give the sequence you designed.
3. Test your sequence for specificity to B27 and
verify that it recognizes only B27 and no other B allele,
nor any other gene, in the human genome.
4. As a followup on HLA B27's association in
disease, you may be interested in reading the following
paper which combines two computational methods to identify
peptide sequences from Chlamydia trachomatis
predicted to be involved in binding B27 and which may be
involved in the pathogenesis of B27 associated disease.
Kuon W, et al, 2001. Identification of
HLA-B27-restricted peptides from the Chlamydia
trachomatis proteome with possible relevance to
HLA-B27-associated diseases. J Immunol Oct
15;167(8):4738-4746.
[top of
page]
Summary Questions:
Try to limit your answers to 2-3 typed pages [12 pt
font]. This length should be sufficient for your
comments and any appropriate copy/pasted examples. [You
need not retype or copy/paste the questions as part of your
responses.]
1. Primers, restriction mapping, and plasmids-
using the tools:
a. What program did you use for primer
design? How did you assess the specificity of the
primers?
b. For primers, it is important to avoid
self-complimentarity, especially at 3' end. Why is
that?
c. What program did you use for restriction
mapping? What enzymes did you select? What were your
results?
d. Describe two uses for doing restriction
mapping on a sequence.
e. How can having a restriction map on an mRNA
or cDNA sequence be useful in helping to select a plasmid
for cloning?
f. Why do some plasmids have several different
restriction sites in specific regions, especially within
an antibiotic gene or an enzyme gene?
g. What factors dictate restriction enzyme
choice? [This may seem a little redundant to the
preceding questions, or it may not, depending on how you
have answered so far.]
2. Designing a probe:
a. Outline your approach for designing a
probe specific for HLA B27.
b. Give the sequence you designed.
c. Summarize how you verified the specificity
of your probe.
[top of
page]
.[
|